Review



aav2 cmv gfp cre virus  (Vector Biolabs)


Bioz Verified Symbol Vector Biolabs is a verified supplier
Bioz Manufacturer Symbol Vector Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Vector Biolabs aav2 cmv gfp cre virus
    Aav2 Cmv Gfp Cre Virus, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp+cre+virus/AAV2-Cre-GFP/pmc08594818-237-3-8
    Average 95 stars, based on 23 article reviews
    aav2 cmv gfp cre virus - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Serotonin transporter-mediated molecular axis regulates regional retinal ganglion cell vulnerability and axon regeneration after nerve injury
    Article Snippet: For axon regeneration assay, 2 μl of 2 μg/μl of Alexa Fluor 555 conjugated cholera toxin β subunit (CTB) (ThermoFisher, C22843) were injected into the central retina 2 days before euthanasia. .. 1 μl of AAV2-CMV-GFP- Cre virus (1x10^13 GC/ml, VECTOR BIOLABS, 7016), AAV2-CMV-GFP-sh Slc6a4 virus (target sequences: GCCCTCTGTTTCTCCTGTTCA) [ ] (1x10^13 GC/ml, VIROVEK, custom-made), AAV2-CMV-GFP-shControl virus (control sequences: GTCTGTTTCCCTCGCTACTCT) (1x10^13 GC/ml, VIROVEK, custom-made), AAV2-CMV-mouse Gpnmb -IRES-eGFP (2.2x10^12 GC/ml, VECTOR BIOLABS, 260538) was slowly intravitreally injected into the peripheral ventral or dorsal retina of 6-week-old WT or transgenic mice. ..

    Control:

    Article Title: Serotonin transporter-mediated molecular axis regulates regional retinal ganglion cell vulnerability and axon regeneration after nerve injury
    Article Snippet: For axon regeneration assay, 2 μl of 2 μg/μl of Alexa Fluor 555 conjugated cholera toxin β subunit (CTB) (ThermoFisher, C22843) were injected into the central retina 2 days before euthanasia. .. 1 μl of AAV2-CMV-GFP- Cre virus (1x10^13 GC/ml, VECTOR BIOLABS, 7016), AAV2-CMV-GFP-sh Slc6a4 virus (target sequences: GCCCTCTGTTTCTCCTGTTCA) [ ] (1x10^13 GC/ml, VIROVEK, custom-made), AAV2-CMV-GFP-shControl virus (control sequences: GTCTGTTTCCCTCGCTACTCT) (1x10^13 GC/ml, VIROVEK, custom-made), AAV2-CMV-mouse Gpnmb -IRES-eGFP (2.2x10^12 GC/ml, VECTOR BIOLABS, 260538) was slowly intravitreally injected into the peripheral ventral or dorsal retina of 6-week-old WT or transgenic mice. ..

    Injection:

    Article Title: Serotonin transporter-mediated molecular axis regulates regional retinal ganglion cell vulnerability and axon regeneration after nerve injury
    Article Snippet: For axon regeneration assay, 2 μl of 2 μg/μl of Alexa Fluor 555 conjugated cholera toxin β subunit (CTB) (ThermoFisher, C22843) were injected into the central retina 2 days before euthanasia. .. 1 μl of AAV2-CMV-GFP- Cre virus (1x10^13 GC/ml, VECTOR BIOLABS, 7016), AAV2-CMV-GFP-sh Slc6a4 virus (target sequences: GCCCTCTGTTTCTCCTGTTCA) [ ] (1x10^13 GC/ml, VIROVEK, custom-made), AAV2-CMV-GFP-shControl virus (control sequences: GTCTGTTTCCCTCGCTACTCT) (1x10^13 GC/ml, VIROVEK, custom-made), AAV2-CMV-mouse Gpnmb -IRES-eGFP (2.2x10^12 GC/ml, VECTOR BIOLABS, 260538) was slowly intravitreally injected into the peripheral ventral or dorsal retina of 6-week-old WT or transgenic mice. ..

    Transgenic Assay:

    Article Title: Serotonin transporter-mediated molecular axis regulates regional retinal ganglion cell vulnerability and axon regeneration after nerve injury
    Article Snippet: For axon regeneration assay, 2 μl of 2 μg/μl of Alexa Fluor 555 conjugated cholera toxin β subunit (CTB) (ThermoFisher, C22843) were injected into the central retina 2 days before euthanasia. .. 1 μl of AAV2-CMV-GFP- Cre virus (1x10^13 GC/ml, VECTOR BIOLABS, 7016), AAV2-CMV-GFP-sh Slc6a4 virus (target sequences: GCCCTCTGTTTCTCCTGTTCA) [ ] (1x10^13 GC/ml, VIROVEK, custom-made), AAV2-CMV-GFP-shControl virus (control sequences: GTCTGTTTCCCTCGCTACTCT) (1x10^13 GC/ml, VIROVEK, custom-made), AAV2-CMV-mouse Gpnmb -IRES-eGFP (2.2x10^12 GC/ml, VECTOR BIOLABS, 260538) was slowly intravitreally injected into the peripheral ventral or dorsal retina of 6-week-old WT or transgenic mice. ..



    Similar Products

    95
    Vector Biolabs aav2 cmv gfp cre virus
    Aav2 Cmv Gfp Cre Virus, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp+cre+virus/AAV2-Cre-GFP/pmc08594818-237-3-8
    Average 95 stars, based on 1 article reviews
    aav2 cmv gfp cre virus - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Vector Biolabs aav2 cmv dio mprcp flag virus vector biolabs customized aav2 cmv dio egfp vector biolabs
    Aav2 Cmv Dio Mprcp Flag Virus Vector Biolabs Customized Aav2 Cmv Dio Egfp Vector Biolabs, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp+cre+virus/AAV2-Cre-GFP/pm33053350-219-140-142
    Average 95 stars, based on 1 article reviews
    aav2 cmv dio mprcp flag virus vector biolabs customized aav2 cmv dio egfp vector biolabs - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Vector Biolabs aav cmv cre egfp virus vector biolabs
    Aav Cmv Cre Egfp Virus Vector Biolabs, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp+cre+virus/AAV2-GFP/pm33053350-219-134-136
    Average 95 stars, based on 1 article reviews
    aav cmv cre egfp virus vector biolabs - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results